Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07562
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209997
Product ID ORK07562
Clone name ef05385
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MYO9B
cDNA sequence DNA sequence (7607 bp)
Predicted protein sequence (2028 aa)
Description
Features of the cloned cDNA sequence

Length: 7607 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1391 bp
Genome contig ID gi42406306f_16947596
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GGCCCCCGCACAGCATGAAATAAAAAGTGCCTGAG
Flanking genome sequence
(237499 - 237548)
----+----*----+----*----+----*----+----*----+----*
AAGTGTGTGCATGGGACGCCTGCTCATATGGGATCGGGCTTGGAAGAACA

Features of the protein sequence

Length: 2028 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06079 0 100.0 MYO9B variant p...
Homo sapiens
NP_001123537 0 100.0 myosin-IXb isof...
Homo sapiens
BAG06734 0 100.0 MYO9B variant p...
Homo sapiens
Q13459 0 99.6 Myosin-IXb; Unc...
Homo sapiens
XP_001114282 0 98.0 similar to myos...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 275 305 PD000355 Myosin head
FPrintScan IPR001609 182 201 PR00193 Myosin head
IPR001609 238 263 PR00193 Myosin head
IPR001609 283 310 PR00193 Myosin head
IPR001609 521 549 PR00193 Myosin head
IPR001609 574 602 PR00193 Myosin head
HMMPfam IPR000159 21 120 PF00788 Ras-association
IPR001609 154 680 PF00063 Myosin head
IPR001609 826 947 PF00063 Myosin head
IPR000048 963 983 PF00612 IQ calmodulin-binding region
IPR000048 986 1006 PF00612 IQ calmodulin-binding region
IPR000048 1008 1028 PF00612 IQ calmodulin-binding region
IPR000048 1031 1051 PF00612 IQ calmodulin-binding region
IPR002219 1639 1690 PF00130 Protein kinase C
IPR000198 1719 1868 PF00620 RhoGAP
HMMSmart IPR000159 21 120 SM00314 Ras-association
IPR001609 146 960 SM00242 Myosin head
IPR000048 961 983 SM00015 IQ calmodulin-binding region
IPR000048 984 1006 SM00015 IQ calmodulin-binding region
IPR000048 1007 1028 SM00015 IQ calmodulin-binding region
IPR000048 1029 1051 SM00015 IQ calmodulin-binding region
IPR002219 1639 1687 SM00109 Protein kinase C
IPR000198 1716 1891 SM00324 RhoGAP
ProfileScan IPR000159 21 120 PS50200 Ras-association
IPR000048 985 1013 PS50096 IQ calmodulin-binding region
IPR000048 1007 1034 PS50096 IQ calmodulin-binding region
IPR000048 1030 1059 PS50096 IQ calmodulin-binding region
IPR002219 1638 1687 PS50081 Protein kinase C
IPR000198 1709 1894 PS50238 RhoGAP
ScanRegExp IPR002219 1639 1687 PS00479 Protein kinase C
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp