ORK00061

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00061

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00061
Clone name	hk01552
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DCLK1
cDNA sequence	DNA sequence (4246 bp) Predicted protein sequence (794 aa)
HaloTag ORF Clone	FHC00061
Flexi ORF Clone	FXC00061
Description	Serine/threonine-protein kinase DCLK1 (EC 2.7.11.1) (Doublecortin-like and CAM kinase-like 1) (Doublecortin-like kinase 1).

Features of the cloned cDNA sequence

Description

Length: 4246 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1736 bp
Genome contig ID	gi51511729r_35145043
PolyA signal sequence (None)	+--------+--------+----*----+---- ATATACTTTAATACCTGAGAGTCTTAAAATTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAACGTTTCTATAGTCCTTTATTTTCAAATGCACATTGATCTTCACTT

Features of the protein sequence

Description

Length: 794 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_522657	0	100.0	doublecortin an...	Pan troglodytes
CAH70657	0	100.0	doublecortin an...	Homo sapiens
O15075	3.4e-210	96.2	Serine/threonin...	Homo sapiens
XP_849124	5.9e-210	96.1	similar to Seri...	Canis lupus fam...
XP_001495011	7.4e-210	99.8	similar to Seri...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	455	711	PD000001	Protein kinase
HMMPfam	IPR003533	139	203	PF03607	Doublecortin
	IPR003533	268	329	PF03607	Doublecortin
	IPR000719	455	712	PF00069	Protein kinase
HMMSmart	IPR003533	117	208	SM00537	Doublecortin
	IPR003533	246	334	SM00537	Doublecortin
	IPR001245	455	710	SM00219	Tyrosine protein kinase
	IPR002290	455	712	SM00220	Serine/threonine protein kinase
ProfileScan	IPR003533	122	208	PS50309	Doublecortin
	IPR003533	251	334	PS50309	Doublecortin
	IPR000719	455	712	PS50011	Protein kinase
ScanRegExp	IPR000719	461	488	PS00107	Protein kinase
ScanRegExp	IPR008271	572	584	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp