Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00111
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00111
Clone name hg04796s2
Vector information
The cDNA fragment was inserted at the ApaI-NotI site of the ...
Symbol SETX
cDNA sequence DNA sequence (11156 bp)
Predicted protein sequence (2690 aa)
Flexi ORF Clone FXC00111
Description senataxin
Features of the cloned cDNA sequence

Length: 11156 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2743 bp
Genome contig ID gi89161216r_134026704
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GAGGAAATGGCAGAATTAAAAGCAGAAACAAGAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGGACATGGATTAGAGGTTATGTATTATGAAGTAAACTACAAGGTACTA

Features of the protein sequence

Length: 2690 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10365 0 100.0 senataxin [synt...
synthetic construct
CAI40854 0 99.9 senataxin [Homo...
Homo sapiens
AAR13367 0 99.8 ataxia/oculomot...
Homo sapiens
Q7Z333 0 99.8 Probable helica...
Homo sapiens
CAD98045 0 99.7 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp