Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00128
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00128
Clone name hk06143
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM131B
cDNA sequence DNA sequence (4355 bp)
Predicted protein sequence (369 aa)
Flexi ORF Clone FXC00128
Description Protein FAM131B.
Features of the cloned cDNA sequence

Length: 4355 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3149 bp
Genome contig ID gi89161213r_142660616
PolyA signal sequence
(ACTAAA,-20)
+----*----+----*----+----*----+----
GCTGTGTTCAATGACACTAAACAGAATGTGGTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCCTCTGACTGTGAGTGTCTTATTTGGGGGATGGAGGAGACTGGGAACA

Features of the protein sequence

Length: 369 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10379 2.4e-139 100.0 FAM131B protein...
synthetic construct
XP_001253375 8.4e-135 97.2 hypothetical pr...
Bos taurus
NP_001020217 6.8e-134 96.1 hypothetical pr...
Rattus norvegicus
NP_083804 1.4e-133 95.8 hypothetical pr...
Mus musculus
XP_001495872 9.3e-132 97.4 hypothetical pr...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp