ORK00150

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00150

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00150
Clone name	hh03471s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KIAA0930
cDNA sequence	DNA sequence (4554 bp) Predicted protein sequence (476 aa)
HaloTag ORF Clone	FHC00150
Flexi ORF Clone	FXC00150
Description	chromosome 22 open reading frame 9

Features of the cloned cDNA sequence

Description

Length: 4554 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3085 bp
Genome contig ID	gi89161203r_43868920
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTAGCCTGGGCAACGAGAGCGAAACTCTGTCTC
Flanking genome sequence (99717 - 99668)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATACATTGGT

Features of the protein sequence

Description

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH38414	8e-204	99.7	C22orf9 protein...	Homo sapiens
EAW73374	2.4e-175	100.0	chromosome 22 o...	Homo sapiens
XP_001789220	3.2e-161	86.5	similar to chro...	Bos taurus
BAC85917	1.9e-160	99.7	unnamed protein...	Homo sapiens
BAF98774	3.4e-160	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp