Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00165
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00165
Clone name ej00891s1
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TRAPPC8
cDNA sequence DNA sequence (5474 bp)
Predicted protein sequence (1452 aa)
Flexi ORF Clone FXC00165
Description KIAA1012
Features of the cloned cDNA sequence

Length: 5474 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 813 bp
Genome contig ID gi51511735r_27563903
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATACTGTAAATAGAATAAAGACATGCTATTCACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATAGCGTATTAGTATCTGTTGATTAGAAAGTCTGGTTTCAAAATATTTT

Features of the protein sequence

Length: 1452 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001159900 0 99.5 similar to Prot...
Pan troglodytes
XP_001495333 0 96.8 similar to Prot...
Equus caballus
XP_537289 0 96.5 similar to Prot...
Canis lupus fam...
XP_523902 0 99.5 similar to Prot...
Pan troglodytes
EDL76098 0 91.2 similar to TRS8...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp