Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00173
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00173
Clone name hj05664s3
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AMOT
cDNA sequence DNA sequence (7498 bp)
Predicted protein sequence (1110 aa)
Flexi ORF Clone FXC00173
Description angiomotin
Features of the cloned cDNA sequence

Length: 7498 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3639 bp
Genome contig ID gi89161218r_111804812
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AGCTAGTTCCAATAAAGTTAAGCAGGTTTAAATCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATTTTAAAATGC

Features of the protein sequence

Length: 1110 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q4VCS5 0 100.0 Angiomotin.
Homo sapiens
XP_001924789 0 93.2 angiomotin [Sus...
Sus scrofa
XP_879786 0 92.7 similar to angi...
Bos taurus
XP_001488656 0 94.1 angiomotin [Equ...
Equus caballus
XP_001101620 4.7e-210 96.4 angiomotin [Mac...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR009114 509 527 PR01807 Angiomotin
IPR009114 532 547 PR01807 Angiomotin
IPR009114 622 636 PR01807 Angiomotin
IPR009114 638 655 PR01807 Angiomotin
IPR009114 697 714 PR01807 Angiomotin
IPR009114 718 735 PR01807 Angiomotin
IPR009114 783 798 PR01807 Angiomotin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp