Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00182
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00182
Clone name ef04224
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CCSER2
cDNA sequence DNA sequence (7621 bp)
Predicted protein sequence (1048 aa)
Flexi ORF Clone FXC00182
Description granule cell antiserum positive 14
Features of the cloned cDNA sequence

Length: 7621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4246 bp
Genome contig ID gi89161187f_85978353
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
TTGGCATAGTAAATAAAAATAAAGTTCATAATTAT
Flanking genome sequence
(289898 - 289947)		 
----+----*----+----*----+----*----+----*----+----*
AAAAGTTCTCTTGTCTTTCTCAACATTGACTCCCATAGTTTGCTTTTTCT

Features of the protein sequence

Length: 1048 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001155519 0 99.3 granule cell an...
 Pan troglodytes
XP_591155 0 86.5 similar to Prot...
 Bos taurus
XP_001155270 0 95.0 granule cell an...
 Pan troglodytes
XP_001085630 0 92.9 similar to gran...
 Macaca mulatta
XP_507884 0 96.6 granule cell an...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR000276 1026 1042 PS00237 Rhodopsin-like GPCR superfamily
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp