ORK00195

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00195

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00195
Clone name	ha03446
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	NELFB
cDNA sequence	DNA sequence (2587 bp) Predicted protein sequence (657 aa)
HaloTag ORF Clone	FHC00195
Flexi ORF Clone	FXC00195
Description	Negative elongation factor B (NELF-B) (Cofactor of BRCA1).

Features of the cloned cDNA sequence

Description

Length: 2587 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	611 bp
Genome contig ID	gi89161216f_139169638
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGATTTTCTCGTATGTAAATAAAAGGCAATTTGGT
Flanking genome sequence (118176 - 118225)	----+--------+--------+--------+--------+----* AAACGTGGAGGCTGAGATGTCTCTGTGCCTGCCCTGAGGTTGGATGTAGC

Features of the protein sequence

Description

Length: 657 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_590381	0	92.5	cofactor of BRC...	Bos taurus
Q8WX92	2.6e-214	100.0	Negative elonga...	Homo sapiens
EDL93635	6.2e-208	96.5	similar to cofa...	Rattus norvegicus
XP_548351	1.6e-206	96.2	similar to cofa...	Canis lupus fam...
Q8C4Y3	2.1e-206	95.8	Negative elonga...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010405	183	657	PF06209	Cofactor of BRCA1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp