Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00198
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00198
Clone name fk10552
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIAA1191
cDNA sequence DNA sequence (2644 bp)
Predicted protein sequence (314 aa)
Flexi ORF Clone FXC00198
Description KIAA1191 (KIAA1191), transcript variant 2, mRNA
Features of the cloned cDNA sequence

Length: 2644 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1535 bp
Genome contig ID gi51511721r_175605674
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CTCGTTTTGACAATAAAAATCCTTACTACTTTCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGTGGCTATTTTTTTGTCCTTTTAACAATAGTTATTCCACTCTACCC

Features of the protein sequence

Length: 314 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB14957 1.2e-108 99.6 unnamed protein...
Homo sapiens
CAH92202 2.5e-106 97.7 hypothetical pr...
Pongo abelii
XP_001083749 4.5e-105 96.0 hypothetical pr...
Macaca mulatta
CAB99231 6.7e-101 99.3 hypothetical pr...
Homo sapiens
XP_852699 4.6e-98 88.1 hypothetical pr...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp