Length: 2934 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
697 bp |
Genome contig ID |
gi51511724r_110555614 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- CAGCATGATGAAAATAAAGATTAGTGTTTCCATTT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAATAAATGTTTTATCCTCCCATAAAATAATAATTATTTCTGTGATTTTA |
Length: 691 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
XP_528216 |
0 |
98.6 |
similar to Golg...
|
Pan troglodytes
|
XP_001087887 |
0 |
97.3 |
similar to Golg...
|
Macaca mulatta
|
Q9NX95 |
0 |
100.0 |
Syntabulin; Syn...
|
Homo sapiens
|
BAG53323 |
0 |
99.8 |
unnamed protein...
|
Homo sapiens
|
BAD72976 |
0 |
99.8 |
Golgi-localized...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
634 |
SFLVDLLAVAAPVVPTVLWAFST |
656 |
PRIMARY |
23 |
2 |
661 |
TDPVYNIGALLRGCCVVALHSL |
682 |
SECONDARY |
22 |