Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00242
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00242
Clone name fk10075
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol URGCP
cDNA sequence DNA sequence (3556 bp)
Predicted protein sequence (933 aa)
Flexi ORF Clone FXC00242
Description up-regulated gene 4 isoform 2
Features of the cloned cDNA sequence

Length: 3556 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 754 bp
Genome contig ID gi89161213r_43782269
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
CACATTGTAGACGCTTAATAAATGTCTGTTAAATG
Flanking genome sequence
(99770 - 99721)		 
----+----*----+----*----+----*----+----*----+----*
AATGAGTGCACAAGTGATGGTAATGGGCAGGTTCTGCCTCTCTGTGCCTT

Features of the protein sequence

Length: 933 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW94174 0 100.0 up-regulated ge...
 Homo sapiens
AAH18426 0 99.8 Up-regulated ge...
 Homo sapiens
AAL83710 0 99.8 up-regulated ge...
 Homo sapiens
Q8TCY9 0 100.0 Protein URG4; H...
 Homo sapiens
XP_519069 0 100.0 hypothetical pr...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR006073 697 717 PR00326 GTP1/OBG
IPR006073 752 767 PR00326 GTP1/OBG
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp