Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00244
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00244
Clone name fh15408
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIAA1522
cDNA sequence DNA sequence (5338 bp)
Predicted protein sequence (1084 aa)
Flexi ORF Clone FXC00244
Description KIAA1522 (KIAA1522), mRNA
Features of the cloned cDNA sequence

Length: 5338 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2083 bp
Genome contig ID gi89161185f_32892164
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TCATTTAAAGATGTTAATTAAATGATTGAAACTTG
Flanking genome sequence
(120996 - 121045)
----+----*----+----*----+----*----+----*----+----*
GCTGTGGCTACTGCTTCTTAATGTGGGGGGGACAGGGCAGTGGTCTGGGC

Features of the protein sequence

Length: 1084 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001164540 0 99.0 hypothetical pr...
Pan troglodytes
XP_001104571 0 95.8 hypothetical pr...
Macaca mulatta
XP_575914 4.5e-153 81.9 hypothetical pr...
Rattus norvegicus
CAM19727 3.6e-151 81.2 novel protein (...
Mus musculus
BAE32933 2.1e-144 76.8 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan NULL 662 674 PR01217 NULL
NULL 712 733 PR01217 NULL
NULL 733 749 PR01217 NULL
NULL 752 769 PR01217 NULL
NULL 825 850 PR01217 NULL
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp