Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00254
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00254
Clone name fh22089
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIAA1598
cDNA sequence DNA sequence (5208 bp)
Predicted protein sequence (653 aa)
Flexi ORF Clone FXC00254
Description Shootin1.
Features of the cloned cDNA sequence

Length: 5208 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3244 bp
Genome contig ID gi89161187r_118532601
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TGACCTGGTTATTGTAATAAATCACCTCTTTGGTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATTTAATTTAGTTATTTTGTTATTCATTGTACATTTTTGCTCTGGTTTT

Features of the protein sequence

Length: 653 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH18259 1.8e-154 100.0 hypothetical pr...
 Homo sapiens
XP_521613 1.8e-152 99.5 hypothetical pr...
 Pan troglodytes
XP_001925670 1.1e-146 93.5 similar to Shoo...
 Sus scrofa
Q8K2Q9 2e-142 91.1 Shootin-1.
 Mus musculus
A0MZ67 2.7e-141 90.8 Shootin-1.
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp