Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00271
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00271
Clone name fh12568
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZC3H12C
cDNA sequence DNA sequence (5614 bp)
Predicted protein sequence (899 aa)
Flexi ORF Clone FXC00271
Description zinc finger CCCH-type containing 12C
Features of the cloned cDNA sequence

Length: 5614 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2914 bp
Genome contig ID gi51511727f_109369091
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTGACAGTTGACTGTGCTTTACACAGTAACTAGC
Flanking genome sequence
(175497 - 175546)
----+----*----+----*----+----*----+----*----+----*
CAGTCTGTTGTCTCTGTGTCTTAGTCCAGAGGGAATAGTACCCAATTGGC

Features of the protein sequence

Length: 899 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10484 0 100.0 zinc finger CCC...
synthetic construct
Q9C0D7 0 100.0 Probable ribonu...
Homo sapiens
XP_522175 0 99.7 zinc finger CCC...
Pan troglodytes
XP_001104883 0 98.3 similar to zinc...
Macaca mulatta
EDL25786 0 91.8 mCG4830 [Mus mu...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp