Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00302
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00302
Clone name ee13591
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol YTHDC1
cDNA sequence DNA sequence (3222 bp)
Predicted protein sequence (772 aa)
Flexi ORF Clone FXC00302
Description YTH domain-containing protein 1 (Putative splicing factor YT521).
Features of the cloned cDNA sequence

Length: 3222 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 773 bp
Genome contig ID gi89161207r_68761639
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTACTGTTTTGTATAAAATAAATTGGTAAAGATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACGGTTATCTTTTGTATCTTTTTCTTATCCAATTGCAGGTTTGTTTTATT

Features of the protein sequence

Length: 772 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96MU7 2.1e-203 100.0 YTH domain-cont...
Homo sapiens
XP_517262 5.7e-203 99.7 splicing factor...
Pan troglodytes
XP_001501576 1.7e-198 97.6 similar to spli...
Equus caballus
NP_808348 9e-197 95.7 YTH domain cont...
Mus musculus
EDL89830 1.7e-195 95.1 splicing factor...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007275 444 540 PF04146 YT521-B-like protein
ProfileScan IPR007275 400 537 PS50882 YT521-B-like protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp