Length: 4930 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
926 bp |
| Genome contig ID |
gi89161216r_116038266 |
PolyA signal sequence (AAGAAA,-32) |
+----*----+----*----+----*----+---- AAAAAGAAAAGAAGACAAAAAAAATACCCAAAGCC |
Flanking genome sequence (99963 - 99914) |
----+----*----+----*----+----*----+----*----+----* ATCCGTGTCTCTGCTGTATGTCATTAACTTTTGCCTTCAATGTCAAGTTT |
Length: 1205 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAG10511 |
0 |
100.0 |
AT-hook-contain...
|
synthetic construct
|
| EAW87419 |
1e-205 |
92.5 |
AT-hook transcr...
|
Homo sapiens
|
| BAB84866 |
1.1e-205 |
92.5 |
FLJ00093 protei...
|
Homo sapiens
|
| AAH55285 |
1.4e-205 |
81.7 |
AT-hook transcr...
|
Homo sapiens
|
| BAB15721 |
2.3e-205 |
76.8 |
FLJ00020 protei...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.