Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00303
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00303
Clone name ph00236
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AKNA
cDNA sequence DNA sequence (4930 bp)
Predicted protein sequence (1205 aa)
Description AT-hook-containing transcription factor.
Features of the cloned cDNA sequence

Length: 4930 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 926 bp
Genome contig ID gi89161216r_116038266
PolyA signal sequence
(AAGAAA,-32)
+----*----+----*----+----*----+----
AAAAAGAAAAGAAGACAAAAAAAATACCCAAAGCC
Flanking genome sequence
(99963 - 99914)
----+----*----+----*----+----*----+----*----+----*
ATCCGTGTCTCTGCTGTATGTCATTAACTTTTGCCTTCAATGTCAAGTTT

Features of the protein sequence

Length: 1205 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10511 0 100.0 AT-hook-contain...
synthetic construct
EAW87419 1e-205 92.5 AT-hook transcr...
Homo sapiens
BAB84866 1.1e-205 92.5 FLJ00093 protei...
Homo sapiens
AAH55285 1.4e-205 81.7 AT-hook transcr...
Homo sapiens
BAB15721 2.3e-205 76.8 FLJ00020 protei...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp