Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00314
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209988
Product ID ORK00314
Clone name ae00014
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FASN
cDNA sequence DNA sequence (8452 bp)
Predicted protein sequence (2548 aa)
Flexi ORF Clone FXC00314
Description Fatty acid synthase (EC 2.3.1.85) [Includes: [Acyl-carrier-protein] S- acetyltransferase (EC 2.3.1.38); [Acyl-carrier-protein] S- malonyltransferase (EC 2.3.1.39); 3-oxoacyl-[acyl-carrier-protein] synthase (EC 2.3.1.41); 3-oxoacyl-[acyl-carrier-protein] r
Features of the cloned cDNA sequence

Length: 8452 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 804 bp
Genome contig ID gi51511734r_77529504
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CTCAGCCTCCCACAATTAAACCGCATGTGATCTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCACCGTCCTTTCTTCCCTCCTCCCTGACCTGGCAGCTGCAAGCTCTCC

Features of the protein sequence

Length: 2548 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06070 0 100.0 FASN variant pr...
Homo sapiens
BAG10519 0 100.0 fatty acid synt...
synthetic construct
EAW89745 0 99.9 fatty acid synt...
Homo sapiens
P49327 0 99.9 Fatty acid synt...
Homo sapiens
AAS09886 0 99.8 fatty acid synt...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014030 39 276 PF00109 Beta-ketoacyl synthase
IPR014031 280 397 PF02801 Beta-ketoacyl synthase
IPR014043 530 847 PF00698 Acyl transferase
IPR013217 1280 1379 PF08242 Methyltransferase type 12
IPR013149 1704 1853 PF00107 Alcohol dehydrogenase
IPR002198 1922 2090 PF00106 Short-chain dehydrogenase/reductase SDR
IPR006163 2162 2228 PF00550 Phosphopantetheine-binding
IPR001031 2279 2538 PF00975 Thioesterase
ProfileScan IPR006163 2160 2216 PS50075 Phosphopantetheine-binding
ScanRegExp IPR014030 189 205 PS00606 Beta-ketoacyl synthase
IPR006162 2188 2203 PS00012 Phosphopantetheine attachment site
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp