Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00325
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00325
Clone name sh03370
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DLEC1
cDNA sequence DNA sequence (5592 bp)
Predicted protein sequence (1755 aa)
Description Deleted in lung and esophageal cancer protein 1 (Deleted in lung cancer protein 1) (DLC-1).
Features of the cloned cDNA sequence

Length: 5592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 322 bp
Genome contig ID gi89161205f_37955728
PolyA signal sequence
(GATAAA,-22)
+----*----+----*----+----*----+----
CCACAGCCACTAAGATAAATTCATGCACTTTTACT
Flanking genome sequence
(183503 - 183552)
----+----*----+----*----+----*----+----*----+----*
ATGCCCATTGCACTTCTCATCCATGGATTTGCCTTGCCTTAAGAATTAAC

Features of the protein sequence

Length: 1755 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11659 0 100.0 deleted in lung...
Homo sapiens
NP_031361 0 99.8 deleted in lung...
Homo sapiens
Q9Y238 0 99.7 Deleted in lung...
Homo sapiens
NP_031363 0 99.8 deleted in lung...
Homo sapiens
XP_001488976 0 80.2 deleted in lung...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp