Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00350
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00350
Clone name fh19752
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM193A
cDNA sequence DNA sequence (5036 bp)
Predicted protein sequence (1435 aa)
Flexi ORF Clone FXC00350
Description Uncharacterized protein C4orf8 (Protein IT14).
Features of the cloned cDNA sequence

Length: 5036 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 698 bp
Genome contig ID gi89161207f_2407201
PolyA signal sequence
(AATACA,-13)		 
+----*----+----*----+----*----+----
TGTCTTTCTTTTTGAAAGATGGAATACATTAGTAC
Flanking genome sequence
(296892 - 296941)		 
----+----*----+----*----+----*----+----*----+----*
AGCAGGAGACCTCGGCTGCTTCTTTCTGCTGGGGGAGTGGGGGGATAGCG

Features of the protein sequence

Length: 1435 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11029 0 100.0 C4orf8 protein ...
 synthetic construct
XP_001148876 0 99.3 hypothetical pr...
 Pan troglodytes
XP_001149023 0 99.4 hypothetical pr...
 Pan troglodytes
XP_001489310 0 92.1 similar to rCG3...
 Equus caballus
XP_001059938 0 88.3 similar to Prot...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp