Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00976
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209993
Product ID ORK00976
Clone name bg00176
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CCDC93
cDNA sequence DNA sequence (6744 bp)
Predicted protein sequence (660 aa)
Flexi ORF Clone FXC00976
Description Coiled-coil domain-containing protein 93.
Features of the cloned cDNA sequence

Length: 6744 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4761 bp
Genome contig ID gi89161199r_118289626
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
CATGTACATGTATTATCTATTAAAAAATAGTTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTTAATTTGGTATACTTTTCTTAATAGAACCAAAATGGAAGAAAAT

Features of the protein sequence

Length: 660 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06075 0 100.0 FLJ10996 varian...
Homo sapiens
XP_515755 0 99.3 coiled-coil dom...
Pan troglodytes
AAH93018 1.3e-210 100.0 Coiled-coil dom...
Homo sapiens
Q567U6 1.1e-209 99.8 Coiled-coil dom...
Homo sapiens
AAH28609 9.5e-209 99.5 Coiled-coil dom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp