Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00986
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00986
Clone name fh15997
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DPYSL3
cDNA sequence DNA sequence (5268 bp)
Predicted protein sequence (593 aa)
Flexi ORF Clone FXC00986
Description Dihydropyrimidinase-related protein 3 (DRP-3) (Unc-33-like phosphoprotein) (ULIP protein) (Collapsin response mediator protein 4) (CRMP-4).
Features of the cloned cDNA sequence

Length: 5268 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3222 bp
Genome contig ID gi51511721r_146650569
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
AATGTAAACCTGGTTATTAAAATAACTATGAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAACATTGTTCTCCAGTCTTCTTCTTTGTGTGATGTGCATTTTCACCT

Features of the protein sequence

Length: 593 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_544332 0 96.9 similar to Dihy...
Canis lupus fam...
Q14195 0 100.0 Dihydropyrimidi...
Homo sapiens
AAH39006 0 99.8 Dihydropyrimidi...
Homo sapiens
CAA69153 0 99.6 ULIP [Homo sapi...
Homo sapiens
XP_001501814 0 98.7 similar to Dihy...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR005847 426 491 PD000518 Dihydroorotase region
HMMPfam IPR006680 87 436 PF01979 Amidohydrolase 1
HMMTigr IPR011778 40 494 TIGR02033 D-hydantoinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp