Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00990
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210016
Product ID ORK00990
Clone name fj09409
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM129B
cDNA sequence DNA sequence (3725 bp)
Predicted protein sequence (739 aa)
Flexi ORF Clone FXC00990
Description Niban-like protein (Protein FAM129B) (Meg-3).
Features of the cloned cDNA sequence

Length: 3725 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1503 bp
Genome contig ID gi89161216r_129207446
PolyA signal sequence
(AATAAA,-16)		 
+----*----+----*----+----*----+----
GTTCATGCTTCTACTAATCAATAAACGCTTTATTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAGCCAGTTGCCTTGAGTGGTGCTGTTGGGGTAGGGGACGGGGGGCCTG

Features of the protein sequence

Length: 739 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06098 0 100.0 C9orf88 variant...
 Homo sapiens
AAQ13825 0 100.0 OC58 [Homo sapi...
 Homo sapiens
Q96TA1 0 99.7 Niban-like prot...
 Homo sapiens
AAK57556 0 99.5 MEG3 [Homo sapi...
 Homo sapiens
XP_001095814 0 97.4 similar to niba...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR001849 61 185 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp