Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00995
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00995
Clone name fk09225
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LSM14A
cDNA sequence DNA sequence (3445 bp)
Predicted protein sequence (498 aa)
Flexi ORF Clone FXC00995
Description LSM14 protein homolog A (Protein SCD6 homolog) (Protein FAM61A) (Putative alpha synuclein-binding protein) (AlphaSNBP).
Features of the cloned cDNA sequence

Length: 3445 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1948 bp
Genome contig ID gi42406306f_39255283
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
AGTTTTTATTCTAAAACAGAATAAAACTGTTCAAT
Flanking genome sequence
(156746 - 156795)
----+----*----+----*----+----*----+----*----+----*
AAAAAATGCTCGTCAAAGTTCTTTCTCTTTAAATAGTAACATTCTGTTTC

Features of the protein sequence

Length: 498 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8ND56 3.2e-155 100.0 Protein LSM14 h...
Homo sapiens
CAD39060 1.1e-154 99.5 hypothetical pr...
Homo sapiens
AAH16842 4.3e-153 100.0 LSM14A protein ...
Homo sapiens
BAB55259 8.9e-153 99.7 unnamed protein...
Homo sapiens
XP_001154782 1.4e-152 99.5 LSM14 homolog A...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp