ORK01005

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01005

Order Kazusa clone(s) from :

Accession No	AB210037
Product ID	ORK01005
Clone name	hk07299
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO1F
cDNA sequence	DNA sequence (4172 bp) Predicted protein sequence (1143 aa)
HaloTag ORF Clone	FHC01005
Flexi ORF Clone	FXC01005
Description	Myosin-If (Myosin-Ie).

Features of the cloned cDNA sequence

Description

Length: 4172 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	738 bp
Genome contig ID	gi42406306r_8391809
PolyA signal sequence (ACTAAA,-18)	+--------+--------+----*----+---- AGCAAAACCCTGTTTCTACTAAAAATTTAAAAAAG
Flanking genome sequence (99865 - 99816)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGCCGGGTGTGGTGGTGCCTGCCTGTAATCCCAGCTACT

Features of the protein sequence

Description

Length: 1143 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06119	100.0	MYO1F variant p...	Homo sapiens
BAG06732	100.0	MYO1F variant p...	Homo sapiens
AAH28071	99.9	Myosin IF [Homo...	Homo sapiens
AAX29922	99.9	myosin IF [synt...	synthetic construct
O00160	99.5	Myosin-If; Myos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	186	221	PD000355	Myosin head
BlastProDom	IPR001452	1089	1141	PD000066	Src homology-3
FPrintScan	IPR001609	92	111	PR00193	Myosin head
	IPR001609	148	173	PR00193	Myosin head
	IPR001609	194	221	PR00193	Myosin head
	IPR001609	426	454	PR00193	Myosin head
	IPR001609	479	507	PR00193	Myosin head
	IPR001452	1089	1099	PR00452	Src homology-3
	IPR001452	1103	1118	PR00452	Src homology-3
	IPR001452	1120	1129	PR00452	Src homology-3
	IPR001452	1131	1143	PR00452	Src homology-3
HMMPfam	IPR001609	64	722	PF00063	Myosin head
	IPR000048	739	759	PF00612	IQ calmodulin-binding region
	IPR010926	761	963	PF06017	Myosin tail 2
	IPR001452	1089	1143	PF00018	Src homology-3
HMMSmart	IPR001609	56	736	SM00242	Myosin head
HMMSmart	IPR001452	1089	1143	SM00326	Src homology-3
ProfileScan	IPR000048	742	767	PS50096	IQ calmodulin-binding region
ProfileScan	IPR001452	1086	1143	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp