Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01007
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210039
Product ID ORK01007
Clone name pf00090
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SGIP1
cDNA sequence DNA sequence (7877 bp)
Predicted protein sequence (856 aa)
Flexi ORF Clone FXC01007
Description SH3-containing GRB2-like protein 3-interacting protein 1 (Endophilin- 3-interacting protein).
Features of the cloned cDNA sequence

Length: 7877 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5205 bp
Genome contig ID gi89161185f_66672457
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CTTAAGTCTCTAAATATTAAAAACAACAACAAAAC
Flanking genome sequence
(314115 - 314164)
----+----*----+----*----+----*----+----*----+----*
ACTTGCCTTTCTCTTGTGTCATTGCTTCAATGTTCTGTCATCTTCTGCAA

Features of the protein sequence

Length: 856 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06121 0 100.0 DKFZp761D221 va...
Homo sapiens
BAG10245 0 100.0 SH3-domain GRB2...
synthetic construct
XP_001162987 0 99.6 SH3-domain GRB2...
Pan troglodytes
XP_001092753 0 99.1 similar to SH3-...
Macaca mulatta
CAB66496 1.9e-210 97.1 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp