Length: 4182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
3225 bp |
Genome contig ID |
gi89161199r_96180041 |
PolyA signal sequence (AATACA,-18) |
+----*----+----*----+----*----+---- TTGTTGTTGTTAGGGAGAATACACATCTTTCTTGG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAGCTGGGAGTGTGTTCTCATTTCATGTCCATTCAGACAAAGCACCATTA |
Length: 275 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
EDL28180 |
1.9e-92 |
96.8 |
transmembrane p...
|
Mus musculus
|
O75204 |
4.5e-89 |
100.0 |
Transmembrane p...
|
Homo sapiens
|
XP_591329 |
9.1e-89 |
99.5 |
similar to Tran...
|
Bos taurus
|
AAI31851 |
2.4e-88 |
99.1 |
Transmembrane p...
|
Rattus norvegicus
|
Q8BGP5 |
8.5e-88 |
98.7 |
Transmembrane p...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
69 |
ASALPGALSITALCTALAEPAW |
90 |
SECONDARY |
22 |
2 |
126 |
TVLLLRVIAAFCFLGILCSLSAF |
148 |
PRIMARY |
23 |
3 |
169 |
AHILTVLQCATVIGFSYWASELI |
191 |
SECONDARY |
23 |
4 |
208 |
VTFAVSFYLVAGAGGASILATAA |
230 |
SECONDARY |
23 |