Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01086
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01086
Clone name pf01083
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZMYM4
cDNA sequence DNA sequence (7755 bp)
Predicted protein sequence (1270 aa)
Flexi ORF Clone FXC01086
Description zinc finger protein 262
Features of the cloned cDNA sequence

Length: 7755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3537 bp
Genome contig ID gi89161185f_35406909
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
CTGTACTAACACATTAAATAAATGTTAATTCCCAC
Flanking genome sequence
(254494 - 254543)		 
----+----*----+----*----+----*----+----*----+----*
ACTACAGTCTGAATTTTTACTAAGTATAGCACTTTGGCTTCTGCAAAACA

Features of the protein sequence

Length: 1270 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX07419 0 100.0 zinc finger, MY...
 Homo sapiens
AAH12093 0 100.0 ZMYM4 protein [...
 Homo sapiens
Q5VZL5 0 100.0 Zinc finger MYM...
 Homo sapiens
AAI27114 0 99.9 ZMYM4 protein [...
 Homo sapiens
XP_513305 0 99.6 hypothetical pr...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010507 84 124 PF06467 Zinc finger
IPR010507 136 179 PF06467 Zinc finger
IPR010507 186 221 PF06467 Zinc finger
IPR010507 232 266 PF06467 Zinc finger
IPR010507 276 314 PF06467 Zinc finger
IPR010507 322 353 PF06467 Zinc finger
IPR010507 430 464 PF06467 Zinc finger
IPR010507 471 510 PF06467 Zinc finger
IPR010507 517 551 PF06467 Zinc finger
HMMSmart IPR011017 63 99 SM00746 TRASH
IPR011017 111 151 SM00746 TRASH
IPR011017 163 201 SM00746 TRASH
IPR011017 208 247 SM00746 TRASH
IPR011017 253 291 SM00746 TRASH
IPR011017 301 337 SM00746 TRASH
IPR011017 409 445 SM00746 TRASH
IPR011017 451 486 SM00746 TRASH
IPR011017 494 532 SM00746 TRASH
IPR011017 538 573 SM00746 TRASH
ScanRegExp IPR001545 211 217 PS00261 Gonadotropin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp