Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01220
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01220
Clone name ej00920
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GEMIN4
cDNA sequence DNA sequence (3549 bp)
Predicted protein sequence (1067 aa)
Flexi ORF Clone FXC01220
Description Component of gems 4 (Gemin-4) (p97).
Features of the cloned cDNA sequence

Length: 3549 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 247 bp
Genome contig ID gi51511734r_494609
PolyA signal sequence
(CATAAA,-27)
+----*----+----*----+----*----+----
CAAACTATCATAAAAATTCTCCTCTTTCGCATCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTCTCTTCTAAGTCGGCCTCAGCAATAGCCCAGGATTAAATATGC

Features of the protein sequence

Length: 1067 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P57678 0 99.8 Component of ge...
Homo sapiens
NP_056536 0 99.7 gemin 4 [Homo s...
Homo sapiens
EAW90654 0 99.6 gem (nuclear or...
Homo sapiens
ACE87641 0 99.6 gem (nuclear or...
synthetic construct
AAH20062 0 99.4 Gem (nuclear or...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp