Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01448
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01448
Clone name bm01139
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CLASRP
cDNA sequence DNA sequence (2118 bp)
Predicted protein sequence (682 aa)
Flexi ORF Clone FXC01448
Description Splicing factor, arginine/serine-rich 16 (Suppressor of white-apricot homolog 2).
Features of the cloned cDNA sequence

Length: 2118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 24 bp
Genome contig ID gi42406306f_50134167
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACCGACATTAGGCAGAAGAGTGGGGGGTGGGGAGG
Flanking genome sequence
(131802 - 131851)
----+----*----+----*----+----*----+----*----+----*
ACAAGGGGGTGGGTAAGGGGCTCAAGCTGTGATGCTGCTGGTTTTATCTC

Features of the protein sequence

Length: 682 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW57317 4.1e-175 100.0 splicing factor...
Homo sapiens
XP_001110131 4.8e-174 99.4 similar to Spli...
Macaca mulatta
XP_001163165 1.3e-172 98.6 similar to SWAP...
Pan troglodytes
AAC82339 1.6e-170 100.0 suppressor of w...
Homo sapiens
Q8N2M8 2.6e-170 99.8 Splicing factor...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp