Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01503
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01503
Clone name bm02982
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol YWHAH
cDNA sequence DNA sequence (1757 bp)
Predicted protein sequence (256 aa)
Flexi ORF Clone FXC01503
Description tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Features of the cloned cDNA sequence

Length: 1757 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 810 bp
Genome contig ID gi89161203f_30570564
PolyA signal sequence
(AATAAA,-24)		 
+----*----+----*----+----*----+----
TTCAATGGGTAAATAAATGCTGCTTTGGGGATATT
Flanking genome sequence
(113027 - 113076)		 
----+----*----+----*----+----*----+----*----+----*
ATCTCTGTTTGGTCTTGATTTTTCCCCCCTCGAGGAACTGTTTAACCAGT

Features of the protein sequence

Length: 256 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q04917 3e-93 100.0 14-3-3 protein ...
 Homo sapiens
2C63 3e-93 100.0

ACH53054 5.5e-93 99.5 tyrosine 3-mono...
 Otolemur garnettii
P68511 1.3e-92 99.1 14-3-3 protein eta.
 Rattus norvegicus
BAE01606 1.6e-92 99.1 unnamed protein...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000308 19 246 PD000600 14-3-3 protein
FPrintScan IPR000308 46 75 PR00305 14-3-3 protein
IPR000308 95 119 PR00305 14-3-3 protein
IPR000308 128 150 PR00305 14-3-3 protein
IPR000308 163 189 PR00305 14-3-3 protein
IPR000308 190 216 PR00305 14-3-3 protein
IPR000308 217 246 PR00305 14-3-3 protein
HMMPfam IPR000308 14 251 PF00244 14-3-3 protein
HMMSmart IPR000308 14 256 SM00101 14-3-3 protein
ScanRegExp IPR000308 52 62 PS00796 14-3-3 protein
IPR000308 226 245 PS00797 14-3-3 protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp