ORK01505

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01505

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01505
Clone name	bm03193
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ETV6
cDNA sequence	DNA sequence (2222 bp) Predicted protein sequence (453 aa)
HaloTag ORF Clone	FHC01505
Flexi ORF Clone	FXC01505
Description	Transcription factor ETV6 (ETS-related protein Tel1) (Tel) (ETS translocation variant 6).

Features of the cloned cDNA sequence

Description

Length: 2222 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	589 bp
Genome contig ID	gi89161190f_11594179
PolyA signal sequence (GATAAA,-9)	+--------+--------+----*----+---- TGAAAAAAAAAAATGCTTTTAAAAAAGATAAAATG
Flanking genome sequence (341657 - 341706)	----+--------+--------+--------+--------+----* AAAAGGAGAGCTCTCTTTTTCTCTCTCTTGCTCTGTTCTTCCCTTGGTCC

Features of the protein sequence

Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P41212	1.7e-177	100.0	Transcription f...	Homo sapiens
XP_528737	8.7e-177	99.5	ets variant gen...	Pan troglodytes
XP_001501296	2.6e-174	98.2	ets variant gen...	Equus caballus
Q0VC65	1.4e-170	96.4	Transcription f...	Bos taurus
XP_543812	1.6e-170	96.2	similar to ets ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000418	340	353	PR00454	Ets
	IPR000418	365	383	PR00454	Ets
	IPR000418	384	402	PR00454	Ets
	IPR000418	403	421	PR00454	Ets
HMMPfam	IPR003118	39	125	PF02198	Sterile alpha motif/pointed
HMMPfam	IPR000418	339	423	PF00178	Ets
HMMSmart	IPR003118	39	125	SM00251	Sterile alpha motif/pointed
HMMSmart	IPR000418	339	425	SM00413	Ets
ProfileScan	IPR000418	340	421	PS50061	Ets
ScanRegExp	IPR000418	387	402	PS00346	Ets

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp