Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01542
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01542
Clone name eh00682
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PHLDB2
cDNA sequence DNA sequence (5499 bp)
Predicted protein sequence (1259 aa)
Flexi ORF Clone FXC01542
Description pleckstrin homology-like domain, family B, member 2
Features of the cloned cDNA sequence

Length: 5499 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1684 bp
Genome contig ID gi89161205f_112961377
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TAAATATATTGAGTTTGGATTAAAATGTTGACATG
Flanking genome sequence
(216409 - 216458)
----+----*----+----*----+----*----+----*----+----*
ATTTCACATTTGAAAATAAACTCATCTCTTATTTTGAAGTTACCTATCTG

Features of the protein sequence

Length: 1259 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93140 0 100.0 LL5 beta protei...
Homo sapiens
Q86SQ0 0 100.0 Pleckstrin homo...
Homo sapiens
CAD42711 0 99.9 LL5 beta protei...
Homo sapiens
XP_001153727 0 99.2 pleckstrin homo...
Pan troglodytes
XP_516644 0 99.2 pleckstrin homo...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 121 390 PD037266 NULL
HMMPfam IPR001849 1150 1252 PF00169 Pleckstrin-like
HMMSmart IPR001849 1150 1254 SM00233 Pleckstrin-like
ProfileScan IPR001849 1149 1252 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp