ORK01555

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01555

Order Kazusa clone(s) from :

Accession No	AB209918
Product ID	ORK01555
Clone name	ej01031
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ANPEP
cDNA sequence	DNA sequence (3645 bp) Predicted protein sequence (977 aa)
HaloTag ORF Clone	FHC01555
Flexi ORF Clone	FXC01555
Description	Aminopeptidase N (EC 3.4.11.2) (hAPN) (Alanyl aminopeptidase) (Microsomal aminopeptidase) (Aminopeptidase M) (gp150) (Myeloid plasma membrane glycoprotein CD13) (CD13 antigen).

Features of the cloned cDNA sequence

Description

Length: 3645 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	453 bp
Genome contig ID	gi51511731r_88029131
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCTAAGAGAAAATGTAAATAAAGGATTTCTAGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGAGACTCATTACTAAACTAAAGCAGGAGTGGGTCAATACAGCAGCTG

Features of the protein sequence

Description

Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93155	100.0	membrane alanin...	Homo sapiens
P15144	99.8	Aminopeptidase ...	Homo sapiens
AAA51719	99.7	aminopeptidase ...	Homo sapiens
CAA31640	99.4	unnamed protein...	Homo sapiens
XP_523153	98.5	membrane alanin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR014782	228	243	PR00756	Peptidase M1
	IPR014782	279	294	PR00756	Peptidase M1
	IPR014782	359	369	PR00756	Peptidase M1
	IPR014782	395	410	PR00756	Peptidase M1
	IPR014782	414	426	PR00756	Peptidase M1
HMMPfam	IPR014782	86	490	PF01433	Peptidase M1
ScanRegExp	IPR006025	395	404	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	18	SKSLGILGILLGVAAVCTIIALS	40	PRIMARY	23