Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01559
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01559
Clone name ek00095
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ERAP2
cDNA sequence DNA sequence (3320 bp)
Predicted protein sequence (964 aa)
Flexi ORF Clone FXC01559
Description leukocyte-derived arginine aminopeptidase
Features of the cloned cDNA sequence

Length: 3320 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 300 bp
Genome contig ID gi51511721f_96141022
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTCCAGCCTGGGTGACTGAGCGAGACTCTGTCTC
Flanking genome sequence
(138345 - 138394)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAAAGAAAAGAAAAGAAAA

Features of the protein sequence

Length: 964 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6P179 0 100.0 Endoplasmic ret...
Homo sapiens
BAC78818 0 99.8 leukocyte-deriv...
Homo sapiens
BAG35716 0 99.8 unnamed protein...
Homo sapiens
XP_001137768 0 99.3 leukocyte-deriv...
Pan troglodytes
Q5RFP3 0 97.3 Endoplasmic ret...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR014782 209 224 PR00756 Peptidase M1
IPR014782 257 272 PR00756 Peptidase M1
IPR014782 335 345 PR00756 Peptidase M1
IPR014782 371 386 PR00756 Peptidase M1
IPR014782 390 402 PR00756 Peptidase M1
HMMPfam IPR014782 73 462 PF01433 Peptidase M1
ScanRegExp IPR006025 371 380 PS00142 Peptidase M
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp