Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01562
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01562
Clone name ek00279
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PABPC1
cDNA sequence DNA sequence (2850 bp)
Predicted protein sequence (683 aa)
Description Polyadenylate-binding protein 1 (Poly(A)-binding protein 1) (PABP 1).
Features of the cloned cDNA sequence

Length: 2850 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 445 bp
Genome contig ID gi51511724r_101684320
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
AAATTCTTGCTTTAATAAAAATTCCTTAAACAGTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
CACGGATTTGCTTTTTTTCAAAGTCTTTATAATTGCCATGCATAAATAGG

Features of the protein sequence

Length: 683 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P11940 2.2e-204 100.0 Polyadenylate-b...
 Homo sapiens
Q5R8F7 4e-204 99.8 Polyadenylate-b...
 Pongo abelii
AAH03870 6.3e-204 99.6 Poly(A) binding...
 Mus musculus
CAH91893 7.9e-204 99.6 hypothetical pr...
 Pongo abelii
Q9EPH8 1.1e-203 99.5 Polyadenylate-b...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 60 131 PF00076 RNA recognition motif
IPR000504 148 217 PF00076 RNA recognition motif
IPR000504 240 310 PF00076 RNA recognition motif
IPR000504 343 412 PF00076 RNA recognition motif
IPR002004 590 661 PF00658 Polyadenylate-binding protein/Hyperplastic disc protein
HMMSmart IPR000504 59 132 SM00360 RNA recognition motif
IPR003954 147 218 SM00361 RNA recognition
IPR000504 147 218 SM00360 RNA recognition motif
IPR003954 239 311 SM00361 RNA recognition
IPR000504 239 311 SM00360 RNA recognition motif
IPR003954 342 413 SM00361 RNA recognition
IPR000504 342 413 SM00360 RNA recognition motif
IPR002004 601 664 SM00517 Polyadenylate-binding protein/Hyperplastic disc protein
HMMTigr IPR006515 58 662 TIGR01628 Polyadenylate binding protein
ProfileScan IPR000504 58 136 PS50102 RNA recognition motif
IPR000504 146 222 PS50102 RNA recognition motif
IPR000504 238 315 PS50102 RNA recognition motif
IPR000504 341 417 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp