Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01565
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01565
Clone name hj01822
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SAP130
cDNA sequence DNA sequence (4573 bp)
Predicted protein sequence (1113 aa)
Flexi ORF Clone FXC01565
Description Histone deacetylase complex subunit SAP130 (130 kDa Sin3-associated polypeptide) (Sin3-associated polypeptide p130).
Features of the cloned cDNA sequence

Length: 4573 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 784 bp
Genome contig ID gi89161199r_128315267
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CCAGACGTTAATAAAGGACTCAAAGAGGTTTTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGCGCAGTTTGCATCTTTTTGTAAAGTGAATCAGTGCCATACTGACC

Features of the protein sequence

Length: 1113 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11020 0 100.0 histone deacety...
synthetic construct
XP_525910 0 99.9 hypothetical pr...
Pan troglodytes
EAW95353 0 100.0 Sin3A-associate...
Homo sapiens
XP_533311 0 96.2 similar to mSin...
Canis lupus fam...
AAI49484 0 96.6 LOC535754 prote...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp