Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01567
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01567
Clone name ff08080
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DMXL1
cDNA sequence DNA sequence (11643 bp)
Predicted protein sequence (3030 aa)
Description Dmx-like 1
Features of the cloned cDNA sequence

Length: 11643 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2472 bp
Genome contig ID gi51511721f_118335077
PolyA signal sequence
(AATATA,-19)		 
+----*----+----*----+----*----+----
GTAGGTTAGGTTTCAGAATATAGCTTGTTTTCACC
Flanking genome sequence None

Features of the protein sequence

Length: 3030 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11024 0 100.0 DmX-like 1 prot...
 synthetic construct
NP_005500 0 99.9 dmX-like protei...
 Homo sapiens
Q9Y485 0 99.8 DmX-like protei...
 Homo sapiens
XP_517890 0 99.3 Dmx-like 1 isof...
 Pan troglodytes
XP_001087241 0 98.2 similar to Dmx-...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 162 192 PF00400 WD40 repeat
IPR001680 224 271 PF00400 WD40 repeat
IPR001680 2879 2917 PF00400 WD40 repeat
IPR001680 2921 2959 PF00400 WD40 repeat
HMMSmart IPR001680 103 139 SM00320 WD40 repeat
IPR001680 161 200 SM00320 WD40 repeat
IPR001680 223 271 SM00320 WD40 repeat
IPR001680 471 510 SM00320 WD40 repeat
IPR001680 962 1004 SM00320 WD40 repeat
IPR001680 2740 2775 SM00320 WD40 repeat
IPR001680 2778 2818 SM00320 WD40 repeat
IPR001680 2830 2872 SM00320 WD40 repeat
IPR001680 2878 2917 SM00320 WD40 repeat
IPR001680 2920 2959 SM00320 WD40 repeat
ProfileScan IPR001680 2885 2968 PS50294 WD40 repeat
IPR001680 2927 2968 PS50082 WD40 repeat
ScanRegExp IPR000209 1106 1116 PS00136 Peptidase S8 and S53
IPR001680 2859 2873 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp