Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01568
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01568
Clone name fh17845
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol STIL
cDNA sequence DNA sequence (5382 bp)
Predicted protein sequence (1294 aa)
Flexi ORF Clone FXC01568
Description SCL-interrupting locus protein (TAL-1-interrupting locus protein).
Features of the cloned cDNA sequence

Length: 5382 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 989 bp
Genome contig ID gi89161185r_47388404
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTTAATAGAACTTAATAAAATGTCTAGATTGACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTCCTTTGTTGTCTGTTATAGTTTATTCTCCACTTTTTAAAAAACTC

Features of the protein sequence

Length: 1294 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q15468 0 100.0 SCL-interruptin...
Homo sapiens
AAA60550 0 99.8 SIL [Homo sapiens].
Homo sapiens
EAX06872 0 99.9 SCL/TAL1 interr...
Homo sapiens
NP_001041631 0 99.9 SCL-interruptin...
Homo sapiens
CAH18699 0 99.7 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp