ORK01569

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01569

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01569
Clone name	fh18536
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh18536 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCAG GAAAAGGGTC TTTTTTGTCT TC) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	BCL9
cDNA sequence	DNA sequence (5812 bp) Predicted protein sequence (1380 aa)
HaloTag ORF Clone	FHC01569
Flexi ORF Clone	FXC01569
Description	B-cell lymphoma 9 protein (Bcl-9) (Legless homolog).

Features of the cloned cDNA sequence

Description

Length: 5812 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1253 bp
Genome contig ID	gi89161185f_145380010
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGGTGTCAGAAAAATAAAATATATTGTTTCTTAC
Flanking genome sequence (184629 - 184678)	----+--------+--------+--------+--------+----* AAAATTGAACTGCCTTTTTTGTTCATTTGGATTCCTGATTGTTTAGTATT

Features of the protein sequence

Description

Length: 1380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11026	100.0	B-cell lymphoma...	synthetic construct
CAI15198	93.8	B-cell CLL/lymp...	Homo sapiens
XP_513752	93.6	B-cell CLL/lymp...	Pan troglodytes
AAI16452	93.8	B-cell CLL/lymp...	Homo sapiens
XP_001094726	93.1	similar to B-ce...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp