ORK01570

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01570

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01570
Clone name	hg00662
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRAPPC10
cDNA sequence	DNA sequence (6320 bp) Predicted protein sequence (1263 aa)
HaloTag ORF Clone	FHC01570
Flexi ORF Clone	FXC01570
Description	Transmembrane protein 1 (Epilepsy holoprosencephaly candidate 1 protein) (EHOC-1) (GT334 protein).

Features of the cloned cDNA sequence

Description

Length: 6320 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2363 bp
Genome contig ID	gi51511750f_44156626
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCAAATGGAAAATAAAATAAGTTATAATTTTTGTG
Flanking genome sequence (193579 - 193628)	----+--------+--------+--------+--------+----* AATTTCATGGGATGTCCTATGATTGGAAAAATTATAACTCTTCTGATTCT

Features of the protein sequence

Description

Length: 1263 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P48553	100.0	Trafficking pro...	Homo sapiens
AAC51826	99.9	GT334 protein [...	Homo sapiens
AAB58468	99.7	GT334 protein [...	Homo sapiens
XP_514933	99.7	transmembrane p...	Pan troglodytes
XP_001103950	98.5	transmembrane p...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001412	599	609	PS00178	Aminoacyl-tRNA synthetase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp