ORK01664

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01664

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01664
Clone name	af06819
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HDAC4
cDNA sequence	DNA sequence (7880 bp) Predicted protein sequence (1097 aa)
HaloTag ORF Clone	FHC01664
Flexi ORF Clone	FXC01664
Description	Histone deacetylase 4 (HD4).

Features of the cloned cDNA sequence

Description

Length: 7880 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3921 bp
Genome contig ID	gi89161199r_239535809
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTGTAAGAAAAATAAAAAGGACTACTTAAACATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTCATATTAAGAAAAAAAGTTTATCTAGCACTTGTGACATACCAATAAT

Features of the protein sequence

Description

Length: 1097 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW71166	100.0	histone deacety...	Homo sapiens
P56524	99.9	Histone deacety...	Homo sapiens
AAX93070	100.0	unknown [Homo s...	Homo sapiens
XP_343630	93.3	similar to hist...	Rattus norvegicus
Q99P99	93.4	Histone deacety...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000286	812	835	PR01270	Histone deacetylase superfamily
	IPR000286	846	861	PR01270	Histone deacetylase superfamily
	IPR000286	937	947	PR01270	Histone deacetylase superfamily
HMMPfam	IPR000286	666	1011	PF00850	Histone deacetylase superfamily

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp