Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01684
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01684
Clone name eh00476
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol INTS2
cDNA sequence DNA sequence (5822 bp)
Predicted protein sequence (1204 aa)
Description Integrator complex subunit 2 (Int2).
Features of the cloned cDNA sequence

Length: 5822 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2189 bp
Genome contig ID gi51511734r_57197512
PolyA signal sequence
(TATAAA,-28)
+----*----+----*----+----*----+----
ATTGGTTTATAAACATTCATATTCTTTATCAAACG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTGTAGTTTTTGTGTTTCATTCCACTAGAGTTAACCTGAAGGGAACG

Features of the protein sequence

Length: 1204 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_511605 0 99.9 hypothetical pr...
Pan troglodytes
CAL38257 0 99.9 hypothetical pr...
synthetic construct
XP_001110216 0 99.5 similar to inte...
Macaca mulatta
EAW51434 0 100.0 integrator comp...
Homo sapiens
XP_001143420 0 99.9 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp