Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01691
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01691
Clone name hj00056
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SCAPER
cDNA sequence DNA sequence (4717 bp)
Predicted protein sequence (1401 aa)
Flexi ORF Clone FXC01691
Description Zinc finger protein 291.
Features of the cloned cDNA sequence

Length: 4717 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 429 bp
Genome contig ID gi51511731r_74327600
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
CCAGCTCTTGAAGTATCTTAAATAAAGACTTAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTTTACCTGCTCTAAATTTAACTTTTTAAGGTCTACGGTAAAGATAT

Features of the protein sequence

Length: 1401 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10459 0 100.0 zinc finger pro...
synthetic construct
EAW99218 0 99.8 zinc finger pro...
Homo sapiens
Q9BY12 0 99.9 S phase cyclin ...
Homo sapiens
XP_523229 0 99.4 zinc finger pro...
Pan troglodytes
XP_001105157 0 98.3 similar to zinc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR003604 790 824 SM00451 Zinc finger
ScanRegExp IPR007087 795 817 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp