Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01699
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01699
Clone name ph00746s1
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLCD3
cDNA sequence DNA sequence (6111 bp)
Predicted protein sequence (819 aa)
Flexi ORF Clone FXC01699
Description phospholipase C, delta 3
Features of the cloned cDNA sequence

Length: 6111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3651 bp
Genome contig ID gi51511734r_40441861
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TTCTTTATTAGAAACAAGTGAGATGTATTGAGCAG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AACAACAATGCATTTGGTATTTCCTCCCCGACCCTGGAAATGGATGCCCC

Features of the protein sequence

Length: 819 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N3E9 0 100.0 1-phosphatidyli...
 Homo sapiens
CAD39054 0 99.8 hypothetical pr...
 Homo sapiens
XP_001115230 0 97.8 similar to phos...
 Macaca mulatta
XP_001142960 0 95.5 phospholipase C...
 Pan troglodytes
AAH31392 0 88.0 Phospholipase C...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013841 378 662 PD001202 Phosphatidylinositol-specific phospholipase C
FPrintScan IPR001192 372 390 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 398 418 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 496 513 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 612 633 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 633 651 PR00390 Phosphoinositide-specific phospholipase C
IPR000008 710 722 PR00360 C2 calcium-dependent membrane targeting
IPR000008 740 753 PR00360 C2 calcium-dependent membrane targeting
IPR000008 762 770 PR00360 C2 calcium-dependent membrane targeting
IPR001192 783 793 PR00390 Phosphoinositide-specific phospholipase C
HMMPfam IPR015359 285 366 PF09279 EF-hand-like
IPR000909 368 513 PF00388 Phosphatidylinositol-specific phospholipase C
IPR001711 557 674 PF00387 Phosphatidylinositol-specific phospholipase C
IPR000008 692 782 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR001849 95 204 SM00233 Pleckstrin-like
IPR000909 367 512 SM00148 Phosphatidylinositol-specific phospholipase C
IPR001711 558 674 SM00149 Phosphatidylinositol-specific phospholipase C
IPR000008 691 797 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR000909 367 512 PS50007 Phosphatidylinositol-specific phospholipase C
IPR001711 558 674 PS50008 Phosphatidylinositol-specific phospholipase C
IPR000008 677 782 PS50004 C2 calcium-dependent membrane targeting
ScanRegExp IPR002048 261 273 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp