Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01900
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01900
Clone name ee14132
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PBXIP1
cDNA sequence DNA sequence (3214 bp)
Predicted protein sequence (751 aa)
Flexi ORF Clone FXC01900
Description pre-B-cell leukemia homeobox interacting protein 1
Features of the cloned cDNA sequence

Length: 3214 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 939 bp
Genome contig ID gi89161185r_153083185
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GGGCTGGGGAAGTGATTAAATAAAAGCAACGCAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATGCCTCTCCTGTTTTGGGCACTCAAAAGTTATTGCCTTCTTTAGG

Features of the protein sequence

Length: 751 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96AQ6 0 100.0 Pre-B-cell leuk...
Homo sapiens
AAG02026 0 99.7 hematopoietic P...
Homo sapiens
CAI13238 0 100.0 pre-B-cell leuk...
Homo sapiens
BAB14059 0 99.5 unnamed protein...
Homo sapiens
XP_514433 0 98.0 pre-B-cell leuk...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp