Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01906
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01906
Clone name ej01062
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TRAPPC11
cDNA sequence DNA sequence (4479 bp)
Predicted protein sequence (1177 aa)
Flexi ORF Clone FXC01906
Description CDNA: FLJ23339 fis, clone HEP13401.
Features of the cloned cDNA sequence

Length: 4479 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 943 bp
Genome contig ID gi89161207f_184717482
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
AGGAAATAGTGATGTAAATAAACATGTTCTCTTTC
Flanking genome sequence
(154254 - 154303)		 
----+----*----+----*----+----*----+----*----+----*
AAGTATGCTTGTCTGTCTCTATCTTTTATTTTGAGCTTGTTTGATTTCAG

Features of the protein sequence

Length: 1177 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAD97983 0 99.8 hypothetical pr...
 Homo sapiens
XP_526747 0 99.6 hypothetical pr...
 Pan troglodytes
BAG11099 0 100.0 FLJ23339 protei...
 synthetic construct
CAL38681 0 99.9 hypothetical pr...
 synthetic construct
BAG53267 0 99.7 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR012880 1016 1167 PF07919 Protein of unknown function DUF1683
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp