Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01908
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01908
Clone name fj09554
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM184A
cDNA sequence DNA sequence (3778 bp)
Predicted protein sequence (1168 aa)
Flexi ORF Clone FXC01908
Description Uncharacterized protein C6orf60.
Features of the cloned cDNA sequence

Length: 3778 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 270 bp
Genome contig ID gi89161210r_119222697
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGTAATTACTGCATAATAAATTTTGTTAGAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACAATGCTTTTTATTTTTTTCTACGTTTGCTTTAATTTTTAAATATTT

Features of the protein sequence

Length: 1168 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI20344 0 100.0 family with seq...
Homo sapiens
ACE87824 0 99.8 chromosome 6 op...
synthetic construct
XP_001163920 0 99.2 similar to chro...
Pan troglodytes
XP_001110223 0 97.9 similar to Temp...
Macaca mulatta
EAW48190 0 100.0 chromosome 6 op...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp