Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01909
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01909
Clone name fj19028
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MMS22L
cDNA sequence DNA sequence (4047 bp)
Predicted protein sequence (1204 aa)
Flexi ORF Clone FXC01909
Description Uncharacterized protein C6orf167.
Features of the cloned cDNA sequence

Length: 4047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 269 bp
Genome contig ID gi89161210r_97601134
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
ATTTTAGTTAAACTAAATTAAAGAAACATTTTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGTGTTTTCTGTGTGTGAGTATTAAGCAGATACTTCATCCATAGACTT

Features of the protein sequence

Length: 1204 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11102 0 100.0 C6orf167 protei...
synthetic construct
BAC87254 0 96.7 unnamed protein...
Homo sapiens
CAI16668 0 99.7 novel protein [...
Homo sapiens
EAW48495 0 95.8 chromosome 6 op...
Homo sapiens
Q6ZRQ5 0 96.5 Uncharacterized...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp