Length: 4047 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
269 bp |
Genome contig ID |
gi89161210r_97601134 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- ATTTTAGTTAAACTAAATTAAAGAAACATTTTCTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AGAGTGTTTTCTGTGTGTGAGTATTAAGCAGATACTTCATCCATAGACTT |
Length: 1204 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAG11102 |
0 |
100.0 |
C6orf167 protei...
|
synthetic construct
|
BAC87254 |
0 |
96.7 |
unnamed protein...
|
Homo sapiens
|
CAI16668 |
0 |
99.7 |
novel protein [...
|
Homo sapiens
|
EAW48495 |
0 |
95.8 |
chromosome 6 op...
|
Homo sapiens
|
Q6ZRQ5 |
0 |
96.5 |
Uncharacterized...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.