Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01912
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01912
Clone name fk07235
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DACT1
cDNA sequence DNA sequence (3721 bp)
Predicted protein sequence (859 aa)
Flexi ORF Clone FXC01912
Description Dapper homolog 1 (hDPR1) (Heptacellular carcinoma novel gene 3 protein).
Features of the cloned cDNA sequence

Length: 3721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1140 bp
Genome contig ID gi51511730f_58074604
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AACATATGCAGTAATAAACCATTTGTTTTACTGCT
Flanking genome sequence
(110143 - 110192)
----+----*----+----*----+----*----+----*----+----*
GTTAAGTTTGTTATTTGGGTATAAAACCAGATGTTTACACCTGTAAATCT

Features of the protein sequence

Length: 859 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYF0 0 100.0 Dapper homolog ...
Homo sapiens
XP_001165895 0 99.4 dapper 1 isofor...
Pan troglodytes
XP_001092593 0 97.2 similar to DAPP...
Macaca mulatta
NP_001072988 7.2e-200 95.5 dapper homolog ...
Homo sapiens
XP_509976 2.2e-198 94.9 dapper 1 isofor...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp