Length: 3721 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
1140 bp |
Genome contig ID |
gi51511730f_58074604 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- AACATATGCAGTAATAAACCATTTGTTTTACTGCT |
Flanking genome sequence (110143 - 110192) |
----+----*----+----*----+----*----+----*----+----* GTTAAGTTTGTTATTTGGGTATAAAACCAGATGTTTACACCTGTAAATCT |
Length: 859 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q9NYF0 |
0 |
100.0 |
Dapper homolog ...
|
Homo sapiens
|
XP_001165895 |
0 |
99.4 |
dapper 1 isofor...
|
Pan troglodytes
|
XP_001092593 |
0 |
97.2 |
similar to DAPP...
|
Macaca mulatta
|
NP_001072988 |
7.2e-200 |
95.5 |
dapper homolog ...
|
Homo sapiens
|
XP_509976 |
2.2e-198 |
94.9 |
dapper 1 isofor...
|
Pan troglodytes
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.